-
PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0
- Backbone size w/o insert (bp) 9175
- Total vector size (bp) 9584
-
Modifications to backboneInsertion of 2nd U6-gRNA scaffold.
-
Vector typeMammalian Expression, Mouse Targeting, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namehumanized CRISPR associated protein 9
-
Alt nameCas9
-
Alt namehSpCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4101
- Promoter CBh
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- T2A-PuroR (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TTTATGGCGAGGCGGCGG
- 3′ sequencing primer puro-variant-R GTGGGCTTGTACTCGGTCAT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameU6-gRNA scaffold 1
-
Insert Size (bp)342
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameU6-gRNA scaffold 2
-
Insert Size (bp)343
- Promoter U6
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer bgh PA F TGCATCGCATTGTCTGAGTAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFeng Zhang
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Modified from pSpCas9(BB)-2A-Puro (PX459) V2.0 (https://www.addgene.org/62988/)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDG459 was a gift from Paul Thomas (Addgene plasmid # 100901 ; http://n2t.net/addgene:100901 ; RRID:Addgene_100901) -
For your References section:
Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression. Adikusuma F, Pfitzner C, Thomas PQ. PLoS One. 2017 Dec 6;12(12):e0187236. doi: 10.1371/journal.pone.0187236. eCollection 2017. PONE-D-17-32080 [pii] PubMed 29211736