Skip to main content

pDG462
(Plasmid #100903)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100903 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9n(BB)-2A-Puro (PX462) V2.0
  • Backbone size w/o insert (bp) 9175
  • Total vector size (bp) 9581
  • Modifications to backbone
    Insertion of 2nd U6-gRNA scaffold.
  • Vector type
    Mammalian Expression, Mouse Targeting, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    humanized CRISPR associated protein 9 Nickase
  • Alt name
    Cas9n
  • Alt name
    hSpCas9n
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4101
  • Mutation
    D10A mutant converts to Nickase
  • Promoter CBh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • T2A-PuroR (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    U6-gRNA scaffold 1
  • Insert Size (bp)
    342
  • Promoter U6

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    U6-gRNA scaffold 2
  • Insert Size (bp)
    343
  • Promoter U6

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer bgh PA F TGCATCGCATTGTCTGAGTAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Modified from pSpCas9n(BB)-2A-Puro (PX462) V2.0 (https://www.addgene.org/62987/)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDG462 was a gift from Paul Thomas (Addgene plasmid # 100903 ; http://n2t.net/addgene:100903 ; RRID:Addgene_100903)
  • For your References section:

    Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression. Adikusuma F, Pfitzner C, Thomas PQ. PLoS One. 2017 Dec 6;12(12):e0187236. doi: 10.1371/journal.pone.0187236. eCollection 2017. PONE-D-17-32080 [pii] PubMed 29211736