CD63 GAEVM-pEGFP C2
(Plasmid #101037)

• Purpose: Expresses CD63 mutant in mammalian cells
• Depositing Lab: Paul Luzio
• Publication: Luzio lab plasmids (unpublished)

Backbone

• Vector backbone: pEGFP C2
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5449
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CD63
• Species: H. sapiens (human)
• Insert Size (bp): 749
• Mutation: Y235A mutant of Addgene plasmid #62964
• GenBank ID: NM_001267698
• Entrez Gene: CD63 (a.k.a. AD1, HOP-26, ME491, MLA1, OMA81H, Pltgp40, TSPAN30)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 5’ CCGACAACCACTACCTGAGC 3’
• 3′ sequencing primer: 5’ ACAAACCACAACTAGAATGCAG 3’

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Y235A mutant of Addgene wild type CD63 plasmid #62964. Y235A is one of the CD63 cytosolic tail mutations used in Rous BA, Reaves BJ, Ihrke G et. al. (2002). Role of adaptor complex AP-3 in targeting wild-type and mutated CD63 to lysosomes. Molecular Biology of the Cell 13(3) 1071–1082.

CD63 differs from NM_001267698 by a single-nucleotide substitution (C387T) that was present in our source cDNA.