Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pH3mCHSH2
(Plasmid #101053)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101053 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEMT-EASY
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 2941
  • Total vector size (bp) 9120
  • Vector type
    Yeast Expression
  • Selectable markers
    G418

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cryptococcus mCherry expression plasmid
  • Species
    Cryptococcus neoformans
  • Promoter Cryptococcus Histone3 promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGTTGTTTCAGGCCTGCGGATG
  • 3′ sequencing primer CCTTCATCAACATTCTGACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mCherry gene is cloned from plasmid pLK25 a gift from Dr. Peter Williamson from NIH.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pH3mCHSH2 was a gift from Jennifer Lodge (Addgene plasmid # 101053 ; http://n2t.net/addgene:101053 ; RRID:Addgene_101053)
  • For your References section:

    A fluorogenic C. neoformans reporter strain with a robust expression of m-cherry expressed from a safe haven site in the genome. Upadhya R, Lam WC, Maybruck B, Donlin MJ, Chang AL, Kayode S, Ormerod KL, Fraser JA, Doering TL, Lodge JK. Fungal Genet Biol. 2017 Sep 1. pii: S1087-1845(17)30136-6. doi: 10.1016/j.fgb.2017.08.008. 10.1016/j.fgb.2017.08.008 PubMed 28870457