Skip to main content

pZyxin-mMaple2
(Plasmid #101150)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101150 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 101150-D50 50 μg of DNA in Tris buffer $495
DNA 101150-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEYFP-N1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human codon optimized mMaple2 fused to zyxin
  • Species
    H. sapiens (human), Synthetic
  • Promoter cmv

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGCTCTGAGCCCATCATGC
  • 3′ sequencing primer GGACAAACCACAACTAGAATGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZyxin-mMaple2 was a gift from Xiaowei Zhuang (Addgene plasmid # 101150 ; http://n2t.net/addgene:101150 ; RRID:Addgene_101150)
  • For your References section:

    Characterization and development of photoactivatable fluorescent proteins for single-molecule-based superresolution imaging. Wang S, Moffitt JR, Dempsey GT, Xie XS, Zhuang X. Proc Natl Acad Sci U S A. 2014 Jun 10;111(23):8452-7. doi: 10.1073/pnas.1406593111. Epub 2014 May 27. 10.1073/pnas.1406593111 PubMed 24912163