Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pZyxin-mMaple3
(Plasmid #101151)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101151 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human codon optimized mMaple3 fused to zyxin
  • Species
    H. sapiens (human), Synthetic
  • Promoter cmv

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGCTCTGAGCCCATCATGC
  • 3′ sequencing primer GGACAAACCACAACTAGAATGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZyxin-mMaple3 was a gift from Xiaowei Zhuang (Addgene plasmid # 101151 ; http://n2t.net/addgene:101151 ; RRID:Addgene_101151)
  • For your References section:

    Characterization and development of photoactivatable fluorescent proteins for single-molecule-based superresolution imaging. Wang S, Moffitt JR, Dempsey GT, Xie XS, Zhuang X. Proc Natl Acad Sci U S A. 2014 Jun 10;111(23):8452-7. doi: 10.1073/pnas.1406593111. Epub 2014 May 27. 10.1073/pnas.1406593111 PubMed 24912163