Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

gTEMP_pcDNA3
(Plasmid #89583)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89583 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 6940
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gTEMP
  • Alt name
    Genetically encoded ratiometric fluorescent thermometer
  • Species
    Synthetic
  • Insert Size (bp)
    1515
  • GenBank ID
    LC132716
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GAAATTAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gTEMP_pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 89583 ; http://n2t.net/addgene:89583 ; RRID:Addgene_89583)
  • For your References section:

    Genetically encoded ratiometric fluorescent thermometer with wide range and rapid response. Nakano M, Arai Y, Kotera I, Okabe K, Kamei Y, Nagai T. PLoS One. 2017 Feb 17;12(2):e0172344. doi: 10.1371/journal.pone.0172344. eCollection 2017. PONE-D-16-44541 [pii] PubMed 28212432