This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #101238)


Item Catalog # Description Quantity Price (USD)
Plasmid 101238 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5216
  • Total vector size (bp) 6311
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    Staphylococcus epidermidis fibrinogen-binding protein SD-repeat protein G
  • Species
    Staphylococcus epidermidis
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7
  • Tags / Fusion Proteins
    • H3V 3C (C terminal on insert)
    • HIS (C terminal on insert)
    • ybbr (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-SdrG_N2N3-HIS-ybbr was a gift from Hermann Gaub (Addgene plasmid # 101238 ; ; RRID:Addgene_101238)
  • For your References section:

    Molecular mechanism of extreme mechanostability in a pathogen adhesin. Milles LF, Schulten K, Gaub HE, Bernardi RC,. Science 30 Mar 2018: Vol. 359, Issue 6383, pp. 1527-1533 10.1126/science.aar2094