Skip to main content

pCZGY3163
(Plasmid #101248)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101248 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCR8 Gateway Entry Vector
  • Backbone size w/o insert (bp) 3545
  • Total vector size (bp) 4320
  • Vector type
    Gateway

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gfp11::rps-18
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    775
  • Entrez Gene
    rps-18 (a.k.a. CELE_Y57G11C.16)
  • Tag / Fusion Protein
    • GFP11

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer ccctctactcaatttcagcaaaaa
  • 3′ sequencing primer tctttaataatgtttgcctcgatc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

When using this clone for publication, please reference:
Noma K, Goncharov A, Ellisman MH, Jin Y. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY3163 was a gift from Yishi Jin (Addgene plasmid # 101248 ; http://n2t.net/addgene:101248 ; RRID:Addgene_101248)
  • For your References section:

    Microtubule-dependent ribosome localization in C. elegans neurons. Noma K, Goncharov A, Ellisman MH, Jin Y. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. 10.7554/eLife.26376 PubMed 28767038