Skip to main content

pAAV hSyn1 ChR2 ET-TC 2A tDimer
(Plasmid #101361)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101361 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4606
  • Total vector size (bp) 7012
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Channelrhodopsin-2
  • Alt name
    ChR2 E123T-T159C
  • Species
    Chlamydomonas
  • Insert Size (bp)
    927
  • Mutation
    E123T , T159C
  • Promoter human Synapsin

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gactcagcgctgcctcagtctg
  • 3′ sequencing primer GCGGTGA CGTGGAGGA GAATC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    synaptophysin-red fluorescent protein
  • Alt name
    tdimer2
  • Species
    Discosoma sp.
  • Insert Size (bp)
    1395
  • Promoter human Synapsin

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggcagaggaagtcttctaacat
  • 3′ sequencing primer cgataatcaacctctggattac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ChR originally from P.Hegemann, HU-Berlin Germany
tDimer originally from R-Tsien USD USA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn1 ChR2 ET-TC 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 101361 ; http://n2t.net/addgene:101361 ; RRID:Addgene_101361)
  • For your References section:

    High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels. Berndt A, Schoenenberger P, Mattis J, Tye KM, Deisseroth K, Hegemann P, Oertner TG. Proc Natl Acad Sci U S A. 2011 May 3;108(18):7595-600. doi: 10.1073/pnas.1017210108. Epub 2011 Apr 19. 10.1073/pnas.1017210108 PubMed 21504945