pAAV hSyn1 ChR2 ET-TC 2A tDimer
(Plasmid
#101361)
-
PurposeHigh efficiency channelrhodopsin, neuron specific promoter, red fluorescent protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101361 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4606
- Total vector size (bp) 7012
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameChannelrhodopsin-2
-
Alt nameChR2 E123T-T159C
-
SpeciesChlamydomonas
-
Insert Size (bp)927
-
MutationE123T , T159C
- Promoter human Synapsin
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer gactcagcgctgcctcagtctg
- 3′ sequencing primer GCGGTGA CGTGGAGGA GAATC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesynaptophysin-red fluorescent protein
-
Alt nametdimer2
-
SpeciesDiscosoma sp.
-
Insert Size (bp)1395
- Promoter human Synapsin
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggcagaggaagtcttctaacat
- 3′ sequencing primer cgataatcaacctctggattac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ChR originally from P.Hegemann, HU-Berlin Germany
tDimer originally from R-Tsien USD USA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV hSyn1 ChR2 ET-TC 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 101361 ; http://n2t.net/addgene:101361 ; RRID:Addgene_101361) -
For your References section:
High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels. Berndt A, Schoenenberger P, Mattis J, Tye KM, Deisseroth K, Hegemann P, Oertner TG. Proc Natl Acad Sci U S A. 2011 May 3;108(18):7595-600. doi: 10.1073/pnas.1017210108. Epub 2011 Apr 19. 10.1073/pnas.1017210108 PubMed 21504945