pET28a-ybbr-HIS-ddFLN4-K10
(Plasmid
#101718)
-
PurposeK10 peptide with ddFLN4 fingerprint domain and N-terminal ybbr tag for covalent immobilization - resulting in high forces
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5216
- Total vector size (bp) 5651
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameddFLN4 fingerprint, K10 peptide
-
SpeciesH. sapiens (human); Dictyostelium discoideum
-
Insert Size (bp)435
-
MutationC18S in ddFLN4
-
Entrez GeneKRT10 (a.k.a. BCIE, BIE, CK10, EHK, EHK2, IHL, K10, KPP)
- Promoter T7
-
Tags
/ Fusion Proteins
- HIS (N terminal on insert)
- ybbr (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-ybbr-HIS-ddFLN4-K10 was a gift from Hermann Gaub (Addgene plasmid # 101718 ; http://n2t.net/addgene:101718 ; RRID:Addgene_101718) -
For your References section:
Molecular mechanism of extreme mechanostability in a pathogen adhesin. Milles LF, Schulten K, Gaub HE, Bernardi RC. Science. 2018 Mar 30;359(6383):1527-1533. doi: 10.1126/science.aar2094. 10.1126/science.aar2094 PubMed 29599244