Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #101772)


Item Catalog # Description Quantity Price (USD)
Plasmid 101772 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    Addgene plasmid # 52962
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 10400
  • Total vector size (bp) 10667
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin ; BleoR marker is outside of LTR and will not be packaged into virus

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    BAF (BANF1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    BANF1 (a.k.a. BAF, BCRP1, D14S1460, NGPS)
  • Promoter EF1a
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATGCCCGCTTTTGAGA
  • 3′ sequencing primer TAAGTGCAGTAGTCGCCGTGAACGT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-BAF was a gift from Daniel Gerlich (Addgene plasmid # 101772 ; ; RRID:Addgene_101772)
  • For your References section:

    DNA Cross-Bridging Shapes a Single Nucleus from a Set of Mitotic Chromosomes. Samwer M, Schneider MWG, Hoefler R, Schmalhorst PS, Jude JG, Zuber J, Gerlich DW. Cell. 2017 Aug 24;170(5):956-972.e23. doi: 10.1016/j.cell.2017.07.038. 10.1016/j.cell.2017.07.038 PubMed 28841419