Skip to main content

pCDH-SIRT6-G60A
(Plasmid #102326)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102326 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDH
  • Backbone size w/o insert (bp) 7348
  • Total vector size (bp) 8452
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SIRT6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1068
  • Mutation
    changed glycine 60 to alanine
  • GenBank ID
    CR457200
  • Entrez Gene
    SIRT6 (a.k.a. SIR2L6, hSIRT6)
  • Promoter CMV
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV
  • 3′ sequencing primer CTCTAGGCACCCGTTCAATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-SIRT6-G60A was a gift from Hening Lin (Addgene plasmid # 102326 ; http://n2t.net/addgene:102326 ; RRID:Addgene_102326)
  • For your References section:

    Identifying the functional contribution of the defatty-acylase activity of SIRT6. Zhang X, Khan S, Jiang H, Antonyak MA, Chen X, Spiegelman NA, Shrimp JH, Cerione RA, Lin H. Nat Chem Biol. 2016 Aug;12(8):614-20. doi: 10.1038/nchembio.2106. Epub 2016 Jun 20. 10.1038/nchembio.2106 PubMed 27322069