pDDGFP-Leu2d-ScVrg4
(Plasmid
#102334)
-
PurposeExpresses WT ScVrg4 in S. cerevisiae cells using Galactose induction, -URA and -Leu selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDDGFP-Leu2d
-
Backbone manufacturerSimon Newstead (Addgene plasmid # 58352)
-
Vector typeYeast Expression
-
Selectable markersLEU2, URA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYGL225W
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneVRG4 (a.k.a. YGL225W, GOG5, LDB3, VAN2, VIG4)
- Promoter GAL1
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATATACCTCTATACTTTAACG
- 3′ sequencing primer CCAGTGAATAATTCTTCACC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDDGFP-Leu2d-ScVrg4 was a gift from Simon Newstead (Addgene plasmid # 102334 ; http://n2t.net/addgene:102334 ; RRID:Addgene_102334) -
For your References section:
Structural basis of nucleotide sugar transport across the Golgi membrane. Parker JL, Newstead S. Nature. 2017 Nov 23;551(7681):521-524. doi: 10.1038/nature24464. Epub 2017 Nov 15. 10.1038/nature24464 PubMed 29143814