Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #102366)


Item Catalog # Description Quantity Price (USD)
Plasmid 102366 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.
  • Backbone size w/o insert (bp) 7500
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    synuclein alpha
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    A silent mutation (333bp downstream of ATG) was introduced to facilitate cloning using EcoRI, but do not affect translation of wildtype protein
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter EF-1a
  • Tag / Fusion Protein
    • NE (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer EF-1a Forward
  • 3′ sequencing primer TTAGCTTTCGTTATCATCATAGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody:

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIN-hSNCA-NE was a gift from Shu Leong Ho (Addgene plasmid # 102366 ; ; RRID:Addgene_102366)
  • For your References section:

    Age-dependent accumulation of oligomeric SNCA/alpha-synuclein from impaired degradation in mutant LRRK2 knockin mouse model of Parkinson disease: role for therapeutic activation of chaperone-mediated autophagy (CMA). Ho PW, Leung CT, Liu H, Pang SY, Lam CS, Xian J, Li L, Kung MH, Ramsden DB, Ho SL. Autophagy. 2019 Apr 14:1-24. doi: 10.1080/15548627.2019.1603545. 10.1080/15548627.2019.1603545 PubMed 30983487