pAAV-EF1a-FLEX-T-RG
(Plasmid
#102368)
-
PurposeExpress cre dependent TVA and SADB19 RG (biscistronic) as an AAV
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102368 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGTB Addgene 26197
-
Backbone manufacturerEM Callaway
- Backbone size w/o insert (bp) 5655
- Total vector size (bp) 7782
-
Modifications to backboneReplaced GFP-2A-TVA with TVA
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTVA E2A-RG
-
SpeciesSynthetic
-
Insert Size (bp)2127
- Promoter Ef1a
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATTTGCCCTTTTTGAGTTTGG
- 3′ sequencing primer GTTGATTATCGATAAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-FLEX-T-RG was a gift from Troy Margrie (Addgene plasmid # 102368 ; http://n2t.net/addgene:102368 ; RRID:Addgene_102368) -
For your References section:
A Circuit for Integration of Head- and Visual-Motion Signals in Layer 6 of Mouse Primary Visual Cortex. Velez-Fort M, Bracey EF, Keshavarzi S, Rousseau CV, Cossell L, Lenzi SC, Strom M, Margrie TW. Neuron. 2018 Apr 4;98(1):179-191.e6. doi: 10.1016/j.neuron.2018.02.023. Epub 2018 Mar 15. 10.1016/j.neuron.2018.02.023 PubMed 29551490