pSG06-pLac-NRI
(Plasmid
#102463)
-
PurposeExpresses NRI protein in E. coli. The expression is controlled by a pLac promoter.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 2616
- Total vector size (bp) 4026
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNRI
-
Alt namentrC
-
Insert Size (bp)1410
-
Entrez GenentrC (a.k.a. NGR_c12970)
- Promoter pLac
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAAACCGAATTTTGCTGGGTG
- 3′ sequencing primer ATGATAAAGAAGACAGTCATAAGTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2017/04/02/122606 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG06-pLac-NRI was a gift from Richard Murray (Addgene plasmid # 102463 ; http://n2t.net/addgene:102463 ; RRID:Addgene_102463) -
For your References section:
Implementation and System Identification of a Phosphorylation-Based Insulator in a Cell-Free Transcription-Translation System. Guo S, Yeung E, Murray RM. bioRxiv 122606 /10.1101/122606