Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC19, containing H2-Kd Balb/c WK10
(Plasmid #102642)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102642 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    puc19
  • Backbone manufacturer
    New England Biolabs, USA
  • Backbone size w/o insert (bp) 2300
  • Total vector size (bp) 6600

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    H2-Kd Balb/c
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4300

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAACCAATCAGTGTCGCCGCG
  • 3′ sequencing primer TAGTGACCCAGATTCTGGAAGTTTATTCATCTATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19, containing H2-Kd Balb/c WK10 was a gift from Sai Reddy (Addgene plasmid # 102642 ; http://n2t.net/addgene:102642 ; RRID:Addgene_102642)
  • For your References section:

    Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange. Kelton W, Waindok AC, Pesch T, Pogson M, Ford K, Parola C, Reddy ST. Sci Rep. 2017 Apr 4;7:45775. doi: 10.1038/srep45775. 10.1038/srep45775 PubMed 28374766