Skip to main content

pMA_Level 1B
(Plasmid #102702)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102702 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    derived from pSB1K3
  • Backbone manufacturer
    Self-made
  • Backbone size w/o insert (bp) 2195
  • Total vector size (bp) 3105
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    J23106:B0034:spisPink:rrnBT1-T7TE
  • Insert Size (bp)
    910

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMA_Level 1B was a gift from Naomi Nakayama (Addgene plasmid # 102702 ; http://n2t.net/addgene:102702 ; RRID:Addgene_102702)
  • For your References section:

    Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly. Andreou AI, Nakayama N. PLoS One. 2018 Jan 2;13(1):e0189892. doi: 10.1371/journal.pone.0189892. eCollection 2018. 10.1371/journal.pone.0189892 PubMed 29293531