pMA_Auxiliary 2
(Plasmid
#102710)
-
PurposeProvides the Middle-to-End linker 2 which assists Level 2 cloning in Mobius Assembly
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonederived from pSB1K3
-
Backbone manufacturerSelf-made
- Backbone size w/o insert (bp) 2267
- Total vector size (bp) 2195
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLinker sequence
-
Insert Size (bp)72
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA_Auxiliary 2 was a gift from Naomi Nakayama (Addgene plasmid # 102710 ; http://n2t.net/addgene:102710 ; RRID:Addgene_102710) -
For your References section:
Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly. Andreou AI, Nakayama N. PLoS One. 2018 Jan 2;13(1):e0189892. doi: 10.1371/journal.pone.0189892. eCollection 2018. 10.1371/journal.pone.0189892 PubMed 29293531