Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

EphA2 430-976 pcDNA3.1
(Plasmid #102738)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102738 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EphA2 N terminal (430-976aa)
  • Alt name
    Eck
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Epha2 (a.k.a. AW545284, Eck, Myk2, Sek-2, Sek2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer ACTGCACTCGAGGATAGGAATCCCCACTGTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EphA2 430-976 pcDNA3.1 was a gift from Jin Chen (Addgene plasmid # 102738 ; http://n2t.net/addgene:102738 ; RRID:Addgene_102738)
  • For your References section:

    EPHA2 Blockade Overcomes Acquired Resistance to EGFR Kinase Inhibitors in Lung Cancer. Amato KR, Wang S, Tan L, Hastings AK, Song W, Lovly CM, Meador CB, Ye F, Lu P, Balko JM, Colvin DC, Cates JM, Pao W, Gray NS, Chen J. Cancer Res. 2016 Jan 15;76(2):305-18. doi: 10.1158/0008-5472.CAN-15-0717. Epub 2016 Jan 7. 10.1158/0008-5472.CAN-15-0717 PubMed 26744526