Skip to main content

pOEM-GED-mCherry
(Plasmid #102781)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 102781 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pOEM1
  • Backbone manufacturer
    MPI-CBG PEP facility
  • Vector type
    Mammalian Expression, Insect Expression ; Baculoviral rescue shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry
  • GenBank ID
    MF685013.1
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI, BmtI, AgeI (unknown if destroyed)
  • 3′ cloning site NotI, EagI, SalI, AccI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ACTGTGTTTGCTGACGCAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOEM-GED-mCherry was a gift from Elly Tanaka (Addgene plasmid # 102781 ; http://n2t.net/addgene:102781 ; RRID:Addgene_102781)
  • For your References section:

    Pseudotyped baculovirus is an effective gene expression tool for studying molecular function during axolotl limb regeneration. Oliveira CR, Lemaitre R, Murawala P, Tazaki A, Drechsel DN, Tanaka EM. Dev Biol. 2018 Jan 15;433(2):262-275. doi: 10.1016/j.ydbio.2017.10.008. Epub 2017 Nov 30. 10.1016/j.ydbio.2017.10.008 PubMed 29198566