Skip to main content

pET15b-pknG
(Plasmid #102814)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102814 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET15b
  • Backbone size w/o insert (bp) 5708
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pknG
  • Species
    Mycobacterium bovis BCG
  • Promoter T7
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer T7 Fwd 5'd[TAATACGACTCACTATAGGG]3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Addgene's quality control sequencing has identified a frameshift mutation near the C-terminus of the pET-15b backbone-resident Lac-I ORF. However, the depositing lab states that this mutation does not affect PknG protein expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET15b-pknG was a gift from Jean Pieters (Addgene plasmid # 102814 ; http://n2t.net/addgene:102814 ; RRID:Addgene_102814)
  • For your References section:

    Protein kinase G from pathogenic mycobacteria promotes survival within macrophages. Walburger A, Koul A, Ferrari G, Nguyen L, Prescianotto-Baschong C, Huygen K, Klebl B, Thompson C, Bacher G, Pieters J. Science. 2004 Jun 18;304(5678):1800-4. Epub 2004 May 20. 10.1126/science.1099384 PubMed 15155913