pLEX307-mFzd8
              
              
                (Plasmid
                
                #102870)
              
            
            
            
          - 
            PurposeExpresses mouse Fzd8 in mammalian cells
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLEX_307
 - 
              Backbone manufacturerAddgene #41392 (provided by David Root)
 - Backbone size w/o insert (bp) 10065
 - Total vector size (bp) 10784
 - 
              Vector typeMammalian Expression, Lentiviral
 - 
                Selectable markersPuromycin
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameFrizzled 8
 - 
                    SpeciesM. musculus (mouse)
 - 
                  Insert Size (bp)2058
 - 
                  MutationT to C substitution at nucleotide 1134, C to T substitution at nucleotide 1140, A to G substitution at nucleotide 1161, T to C substitution at nucleotide 1287, C to T substitution at nucleotide 1551 of Fzd 8 ORF; all substitution are silent and do not alter amino acid sequence.
 - 
                        Entrez GeneFzd8 (a.k.a. Fz8)
 - Promoter EF1A
 
Cloning Information
- Cloning method Gateway Cloning
 - 5′ sequencing primer EF1A promoter forward (TCAAGCCTCAGACAGTGGTTC) (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Addgene Notes
 - 
            A portion of this plasmid was derived from a plasmid made byInsert was PCR amplified from Addgene plasmid #42270 (provided by Jeremy Nathans and Chris Garcia) and subcloned into a modified pENTR-2B vector using FseI and AscI sites.
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pLEX307-mFzd8 was a gift from Henry Ho (Addgene plasmid # 102870 ; http://n2t.net/addgene:102870 ; RRID:Addgene_102870) - 
                
For your References section:
Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates. Susman MW, Karuna EP, Kunz RC, Gujral TS, Cantu AV, Choi SS, Jong BY, Okada K, Scales MK, Hum J, Hu LS, Kirschner MW, Nishinakamura R, Yamada S, Laird DJ, Jao LE, Gygi SP, Greenberg ME, Ho HH. Elife. 2017 Sep 8;6. pii: e26509. doi: 10.7554/eLife.26509. 10.7554/eLife.26509 PubMed 28885975