Skip to main content

pCKTRBS-CbnR-ABE44898-OD
(Plasmid #102925)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102925 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCKTRBS-OD
  • Backbone size w/o insert (bp) 4158
  • Total vector size (bp) 5607

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CbnR-ABE44898-OD (ChTFBz01)
  • Insert Size (bp)
    1449
  • Promoter PtetO

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer pCKPolyF1 (GAATTCGAGCTCGGTACCCGGG)
  • 3′ sequencing primer pCKPolyR1 (GCGGCCGCAAGCTTGCATG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCKTRBS-CbnR-ABE44898-OD was a gift from George Church (Addgene plasmid # 102925 ; http://n2t.net/addgene:102925 ; RRID:Addgene_102925)
  • For your References section:

    Biosensor libraries harness large classes of binding domains for construction of allosteric transcriptional regulators. Juarez JF, Lecube-Azpeitia B, Brown SL, Johnston CD, Church GM. Nat Commun. 2018 Aug 6;9(1):3101. doi: 10.1038/s41467-018-05525-6. 10.1038/s41467-018-05525-6 PubMed 30082754