pCKTRBS-LmrR-BzdB1_nSP
(Plasmid
#102926)
-
PurposepCKTRBS derivative carrying LmrR-BzdB1_nSP chimera, also known as ChBz02
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCKTRBS
- Backbone size w/o insert (bp) 4047
- Total vector size (bp) 5388
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLmrR-BzdB1_nSP
-
Insert Size (bp)1341
- Promoter PtetO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pCKPolyF1 (GAATTCGAGCTCGGTACCCGGG)
- 3′ sequencing primer pCKPolyR1 (GCGGCCGCAAGCTTGCATG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCKTRBS-LmrR-BzdB1_nSP was a gift from George Church (Addgene plasmid # 102926 ; http://n2t.net/addgene:102926 ; RRID:Addgene_102926) -
For your References section:
Biosensor libraries harness large classes of binding domains for construction of allosteric transcriptional regulators. Juarez JF, Lecube-Azpeitia B, Brown SL, Johnston CD, Church GM. Nat Commun. 2018 Aug 6;9(1):3101. doi: 10.1038/s41467-018-05525-6. 10.1038/s41467-018-05525-6 PubMed 30082754