Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHCD1B
(Plasmid #102953)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102953 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    BCMGSNeo
  • Backbone manufacturer
    Karasuyama, Kudo & Melchers, 1990
  • Backbone size w/o insert (bp) 13940
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD1B cDNA
  • Alt name
    NM_001764
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1021
  • Entrez Gene
    CD1B (a.k.a. CD1, CD1A, R1)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTTGTTGTGCTGTCTCATC
  • 3′ sequencing primer TGCACCTGAGGAGTGAATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHCD1B was a gift from Gennaro De Libero & Lucia Mori (Addgene plasmid # 102953 ; http://n2t.net/addgene:102953 ; RRID:Addgene_102953)
  • For your References section:

    CD1a and CD1b surface expression is independent from de novo synthesized glycosphingolipids. Manolova V, Hirabayashi Y, Mori L, De Libero G. Eur J Immunol. 2003 Jan;33(1):29-37. 10.1002/immu.200390004 PubMed 12594829