Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1P shNFS1_4
(Plasmid #102966)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102966 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1P
  • Backbone manufacturer
    Broad Institute
  • Backbone size w/o insert (bp) 7466
  • Total vector size (bp) 7518
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shNFS1_4
  • gRNA/shRNA sequence
    GCGCACTCTTCTATCAGGTTT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_021100
  • Entrez Gene
    NFS1 (a.k.a. COXPD52, HUSSY-08, IscS, NIFS)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The RNAi Consortium
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

TRCN0000180881

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1P shNFS1_4 was a gift from Richard Possemato (Addgene plasmid # 102966 ; http://n2t.net/addgene:102966 ; RRID:Addgene_102966)
  • For your References section:

    NFS1 undergoes positive selection in lung tumours and protects cells from ferroptosis. Alvarez SW, Sviderskiy VO, Terzi EM, Papagiannakopoulos T, Moreira AL, Adams S, Sabatini DM, Birsoy K, Possemato R. Nature. 2017 Nov 22. doi: 10.1038/nature24637. 10.1038/nature24637 PubMed 29168506