Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #102994)


Item Catalog # Description Quantity Price (USD)
Plasmid 102994 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Total vector size (bp) 6502
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Although Stable strains are highly recommended, regular strains (eg, DH5alpha) can be used for better yield.
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
  • Promoter human synapsin I promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer GTCGACTCCGGAATAACTTCGTA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-synp-F-H2B-GCaMP6f was a gift from David Cox (Addgene plasmid # 102994 ; ; RRID:Addgene_102994)
  • For your References section:

    High-speed volumetric imaging of neuronal activity in freely moving rodents. Skocek O, Nobauer T, Weilguny L, Martinez Traub F, Xia CN, Molodtsov MI, Grama A, Yamagata M, Aharoni D, Cox DD, Golshani P, Vaziri A. Nat Methods. 2018 Jun;15(6):429-432. doi: 10.1038/s41592-018-0008-0. Epub 2018 May 7. 10.1038/s41592-018-0008-0 PubMed 29736000