Skip to main content

pUC19-E6I4Q5
(Plasmid #103101)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 103101 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 103101-D50 50 μg of DNA in Tris buffer $495
DNA 103101-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    NEB(New England Biolabs)
  • Vector type
    CRISPR ; Cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E6I4Q5(Cas9 coding gene from Enterococcus faecalis TX0012)
  • Insert Size (bp)
    3450
  • Mutation
    human codon-optimized

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gctgcaaggcgattaagttg
  • 3′ sequencing primer cggctcgtatgttgtgtgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-E6I4Q5 was a gift from Duhee Bang (Addgene plasmid # 103101 ; http://n2t.net/addgene:103101 ; RRID:Addgene_103101)
  • For your References section:

    High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides. Cho N, Seo HN, Ryu T, Kwon E, Huh S, Noh J, Yeom H, Hwang B, Ha H, Lee JH, Kwon S, Bang D. Nucleic Acids Res. 2018 May 18;46(9):e55. doi: 10.1093/nar/gky112. 10.1093/nar/gky112 PubMed 29529247