Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pUC19-E6I4Q5
(Plasmid #103101)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 103101 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    NEB(New England Biolabs)
  • Vector type
    CRISPR ; Cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E6I4Q5(Cas9 coding gene from Enterococcus faecalis TX0012)
  • Insert Size (bp)
    3450
  • Mutation
    human codon-optimized

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gctgcaaggcgattaagttg
  • 3′ sequencing primer cggctcgtatgttgtgtgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-E6I4Q5 was a gift from Duhee Bang (Addgene plasmid # 103101 ; http://n2t.net/addgene:103101 ; RRID:Addgene_103101)
  • For your References section:

    High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides. Cho N, Seo HN, Ryu T, Kwon E, Huh S, Noh J, Yeom H, Hwang B, Ha H, Lee JH, Kwon S, Bang D.. Nucleic Acids Research (2018) gky112 10.1093/nar/gky112