Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CFP-FRBx5
(Plasmid #103774)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 103774 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pECFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6305
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CFP-FRBx5
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • ECFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GGAGGTCTATATAAGCAGAGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CFP-FRBx5 was a gift from Takanari Inoue (Addgene plasmid # 103774 ; http://n2t.net/addgene:103774 ; RRID:Addgene_103774)
  • For your References section:

    Intracellular production of hydrogels and synthetic RNA granules by multivalent molecular interactions. Nakamura H, Lee AA, Afshar AS, Watanabe S, Rho E, Razavi S, Suarez A, Lin YC, Tanigawa M, Huang B, DeRose R, Bobb D, Hong W, Gabelli SB, Goutsias J, Inoue T. Nat Mater. 2017 Nov 6. pii: nmat5006. doi: 10.1038/nmat5006. 10.1038/nmat5006 PubMed 29115293