-
Purposeexpresses iPOLYMER component in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 103776 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepECFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6367
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecyto-CFP-FRBx5
-
SpeciesSynthetic
- Promoter CMV
-
Tag
/ Fusion Protein
- ECFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer GGAGGTCTATATAAGCAGAGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cyto-CFP-FRBx5 was a gift from Takanari Inoue (Addgene plasmid # 103776 ; http://n2t.net/addgene:103776 ; RRID:Addgene_103776) -
For your References section:
Intracellular production of hydrogels and synthetic RNA granules by multivalent molecular interactions. Nakamura H, Lee AA, Afshar AS, Watanabe S, Rho E, Razavi S, Suarez A, Lin YC, Tanigawa M, Huang B, DeRose R, Bobb D, Hong W, Gabelli SB, Goutsias J, Inoue T. Nat Mater. 2017 Nov 6. pii: nmat5006. doi: 10.1038/nmat5006. 10.1038/nmat5006 PubMed 29115293