pUDP025
(Plasmid #103874)

• Purpose: Broad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces lactis
• Depositing Lab: Jean-Marc Daran
• Publication: Juergens et al FEMS Yeast Res. 2018 May 1;18(3). pii: 4847887. doi: 10.1093/femsyr/foy012.

Backbone

• Vector backbone: pUDP002
• Backbone manufacturer: Juergens H et al. Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA expression plasmid
• Backbone size w/o insert (bp): 10046
• Total vector size (bp): 10237
• Vector type: Yeast Expression, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HH-gRNA-HDV targetting ADE2 in Kluyveromyces lactis
• gRNA/shRNA sequence: CAAATTGAAACTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCTTTCAATACCTCA AGTGCTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCC GGCTGGGCAACATGCTTCGGCATGGCGAATGGGAC
• Species: Kluyveromyces lactis
• GenBank ID: XM_454067
• Promoter: ScTDH3

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: ACATCGTAGGTGTCTGGGTGAAC
• 3′ sequencing primer: CTTTTCGGTTAGAGCGGATGTGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: A patent describing the use of the panARSOPT sequence used in pUDP series is pending (Pan-yeast autonomously replicating sequence WO2014131056 A1). The legal status of Cas9 application is not yet sorted out The Spcas9D147Y P411T gene presents on pUDP025 is derived from pCT (Plasmid #60620) obtained from Addgene under Material Transfer Agreement Instructions (Order 211742- our reference TNW15.216)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry