Skip to main content
Addgene
Open Menu

GEVAL30
(Plasmid #104178)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104178 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-SV4-puro lentiviral vector
  • Backbone size w/o insert (bp) 7740
  • Total vector size (bp) 9270
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GEVAL30
  • Species
    Synthetic
  • Insert Size (bp)
    1530

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer pLV-SV4-puro forward TAGTGAACCGTCAGATCGCC
  • 3′ sequencing primer pLV-SV4-puro reverse TTCCACACCTGGTTGCTGAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rui Sousa Dept. of Biochemistry University of Texas Health Science Center

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GEVAL30 was a gift from Mikhail Nikiforov (Addgene plasmid # 104178)

  • For your References section:

    Internally ratiometric fluorescent sensors for evaluation of intracellular GTP levels and distribution. Bianchi-Smiraglia A, Rana MS, Foley CE, Paul LM, Lipchick BC, Moparthy S, Moparthy K, Fink EE, Bagati A, Hurley E, Affronti HC, Bakin AV, Kandel ES, Smiraglia DJ, Feltri ML, Sousa R, Nikiforov MA. Nat Methods. 2017 Oct;14(10):1003-1009. doi: 10.1038/nmeth.4404. Epub 2017 Sep 4. 10.1038/nmeth.4404 PubMed 28869758
Related items: