1kb Zfp521 promoter reporter
(Plasmid #104188)

• Purpose: luciferase reporter to assay Zfp521 promoter activation
• Depositing Lab: Kathryn Hentges
• Depositing Organization: University of Manchester
  Located in the United Kingdom of Great Britain and Northern Ireland
• Publication: Yu et al Genesis. 2016 Oct;54(10):519-533. doi: 10.1002/dvg.22963. Epub 2016 Aug 29.

Backbone

• Vector backbone: pGL3-Basic
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 5802
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Zfp521 promoter - 1 Kb
• Alt name: Evi3
• Species: M. musculus (mouse)
• Entrez Gene: Zfp521 (a.k.a. B930086A16Rik, Evi3, Znf521)
• Promoter: none
• Tag / Fusion Protein:
  • luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: RVprimer3 . CTAGCAAAATAGGCTGTCCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pGL3 backbone is a promoterless vector used for measuring the activity of inserted promoter sequences with a luciferase assay.

Primers used to clone 1Kb Zfp521 promoter:
Forward: cgtttaaaaactattttcttatccaga
Reverse: aatggaaaatccaagcaagg

DNA (Catalog # 104188-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 104188-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.