Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET42b-AncBE4max
(Plasmid #165157)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 165157 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET42b
  • Backbone size w/o insert (bp) 5218
  • Total vector size (bp) 10771
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AncBE4max
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5553
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    https://www.addgene.org/112094/

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET42b-AncBE4max was a gift from Taekjip Ha (Addgene plasmid # 165157 ; http://n2t.net/addgene:165157 ; RRID:Addgene_165157)
  • For your References section:

    Cas9 deactivation with photocleavable guide RNAs. Zou RS, Liu Y, Wu B, Ha T. Mol Cell. 2021 Apr 1;81(7):1553-1565.e8. doi: 10.1016/j.molcel.2021.02.007. Epub 2021 Mar 3. 10.1016/j.molcel.2021.02.007 PubMed 33662274