pSR26-2
(Plasmid
#104335)
-
PurposeExpresses ompR from a TetR reuglated promoter under inducible ATC control.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104335 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1
- Total vector size (bp) 3624
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB10b
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOmpR
-
SpeciesEscherichia coli str. K-12 substr. MG1655
-
Insert Size (bp)720
-
Entrez GeneompR (a.k.a. b3405, ECK3392, cry, kmt, ompB)
- Promoter PLTetO1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TTGGAACCTCTTACGTGCCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSR26-2 was a gift from Jeffrey Tabor (Addgene plasmid # 104335 ; http://n2t.net/addgene:104335 ; RRID:Addgene_104335) -
For your References section:
Phosphatase activity tunes two-component system sensor detection threshold. Landry BP, Palanki R, Dyulgyarov N, Hartsough LA, Tabor JJ. Nat Commun. 2018 Apr 12;9(1):1433. doi: 10.1038/s41467-018-03929-y. 10.1038/s41467-018-03929-y PubMed 29650958