pEGFPC1-hVAP-B KD/MD
(Plasmid #104450)

• Purpose: Expression of human VAP-B (mutant K87D/M89D, unable to bind FFAT motifs) fused to GFP in mammalian cells
• Depositing Lab: Catherine Tomasetto
• Depositing Organization: Institut de Genetique et de Biologie Moleculaire et Cellulaire (IGBMC)
  Located in France
• Publication: Alpy et al J Cell Sci. 2013 Dec 1;126(Pt 23):5500-12. doi: 10.1242/jcs.139295. Epub 2013 Oct 8.
• Citations: 3 Articles

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 5506
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: vesicle-associated membrane protein-associated protein B
• Alt name: VAP-B
• Species: H. sapiens (human)
• Insert Size (bp): 732
• Mutation: changed K87 to D and M89 to D
• GenBank ID: NM_004738.3
• Entrez Gene: VAPB (a.k.a. ALS8, VAMP-B, VAP-B)
• Tags / Fusion Proteins:
  • EGFP (N terminal on backbone)
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (destroyed during cloning)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: GATCACATGGTCCTGCTG
• 3′ sequencing primer: GAGGTTTTACTTGCTTTAAA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Kentaro Hanada (VAP-B cDNA) Reference: Kawano M et al, J Biol Chem. 2006 Oct 6;281(40):30279-88. PMID: 16895911

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 104450-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 104450-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.