Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #104447)


Item Catalog # Description Quantity Price (USD)
Plasmid 104447 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 5485
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    vesicle-associated membrane protein-associated protein A
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    VAPA (a.k.a. VAP-33, VAP-A, VAP33, hVAP-33)
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer GATCACATGGTCCTGCTG
  • 3′ sequencing primer GAGGTTTTACTTGCTTTAAA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFPC1-hVAP-A was a gift from Catherine Tomasetto (Addgene plasmid # 104447 ; ; RRID:Addgene_104447)
  • For your References section:

    STARD3 or STARD3NL and VAP form a novel molecular tether between late endosomes and the ER. Alpy F, Rousseau A, Schwab Y, Legueux F, Stoll I, Wendling C, Spiegelhalter C, Kessler P, Mathelin C, Rio MC, Levine TP, Tomasetto C. J Cell Sci. 2013 Dec 1;126(Pt 23):5500-12. doi: 10.1242/jcs.139295. Epub 2013 Oct 8. 10.1242/jcs.139295 PubMed 24105263