Skip to main content

pET28b – E. coli RecE residues 564-868
(Plasmid #104534)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104534 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28b
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5368
  • Total vector size (bp) 6280
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RecE residues 564-866 (C-terminal nuclease domain)
  • Species
    E. coli
  • Insert Size (bp)
    912
  • Promoter T7
  • Tag / Fusion Protein
    • 6X-His tag followed by thrombin site

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer T7-F TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28b – E. coli RecE residues 564-868 was a gift from Charles Bell (Addgene plasmid # 104534 ; http://n2t.net/addgene:104534 ; RRID:Addgene_104534)
  • For your References section:

    Crystal structure of E. coli RecE protein reveals a toroidal tetramer for processing double-stranded DNA breaks. Zhang J, Xing X, Herr AB, Bell CE. Structure. 2009 May 13;17(5):690-702. doi: 10.1016/j.str.2009.03.008. 10.1016/j.str.2009.03.008 PubMed 19446525