optoPKAW196R
(Plasmid
#104548)
-
PurposeExpresses Cry2-mCherry-PKA W196R in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of North Carolina at Chapel Hill
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 104548-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 104548-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmCherryCry2
-
Backbone manufacturerChandra Tucker
- Backbone size w/o insert (bp) 6219
- Total vector size (bp) 7272
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCry2-mCherry-PKA W196R
-
Alt nameoptoPKA
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)3327
-
MutationPKA W196R
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPKA catalytic subunit was a gift from Dr. Susan Taylor.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 104548-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 104548-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
optoPKAW196R was a gift from David Lawrence (Addgene plasmid # 104548 ; http://n2t.net/addgene:104548 ; RRID:Addgene_104548) -
For your References section:
Design and Profiling of a Subcellular Targeted Optogenetic cAMP-Dependent Protein Kinase. O'Banion CP, Priestman MA, Hughes RM, Herring LE, Capuzzi SJ, Lawrence DS. Cell Chem Biol. 2017 Oct 25. pii: S2451-9456(17)30355-0. doi: 10.1016/j.chembiol.2017.09.011. 10.1016/j.chembiol.2017.09.011 PubMed 29104065