Skip to main content

pICH47732:PtFCP:ShBle
(Plasmid #104893)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104893 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pICH47732
  • Backbone size w/o insert (bp) 4386
  • Total vector size (bp) 5243
  • Vector type
    Phaeodactylum; Golden Gate Assembly
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShBle
  • Alt name
    Bleomycin resistance protein
  • Tag / Fusion Protein
    • PtFCP promoter and terminator

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer ggataaaccttttcacgccc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pPha-TI plasmid, described in Zaslavskaia L, Lippmeier C, Kroth P. Grossman A, Apt Kirk. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. Was domesticated by removing and BpiI sites through site directed mutagenesis from the FCP promoter and terminator, was then inserted into an L1 pICH47732 vector.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This construct was assembled using Golden Gate Cloning.

Please visit https://www.biorxiv.org/content/early/2018/10/17/444109 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICH47732:PtFCP:ShBle was a gift from Thomas Mock (Addgene plasmid # 104893 ; http://n2t.net/addgene:104893 ; RRID:Addgene_104893)
  • For your References section:

    Biochemical Characterization of a Novel Redox-Regulated Metacaspase in a Marine Diatom. Graff van Creveld S, Ben-Dor S, Mizrachi A, Alcolombri U, Hopes A, Mock T, Rosenwasser S, Vardi A. Front Microbiol. 2021 Sep 8;12:688199. doi: 10.3389/fmicb.2021.688199. eCollection 2021. 10.3389/fmicb.2021.688199 PubMed 34566902
Commonly requested with: