pICH47732:PtFCP:ShBle
(Plasmid
#104893)
-
PurposeExpresses ShBle with FCP promoter/terminator, Golden Gate Assembly, for Phaeodactylum transformation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICH47732
- Backbone size w/o insert (bp) 4386
- Total vector size (bp) 5243
-
Vector typePhaeodactylum; Golden Gate Assembly
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameShBle
-
Alt nameBleomycin resistance protein
-
Tag
/ Fusion Protein
- PtFCP promoter and terminator
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ggataaaccttttcacgccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypPha-TI plasmid, described in Zaslavskaia L, Lippmeier C, Kroth P. Grossman A, Apt Kirk. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. Was domesticated by removing and BpiI sites through site directed mutagenesis from the FCP promoter and terminator, was then inserted into an L1 pICH47732 vector.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was assembled using Golden Gate Cloning.
Please visit https://www.biorxiv.org/content/early/2018/10/17/444109 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH47732:PtFCP:ShBle was a gift from Thomas Mock (Addgene plasmid # 104893 ; http://n2t.net/addgene:104893 ; RRID:Addgene_104893) -
For your References section:
Biochemical Characterization of a Novel Redox-Regulated Metacaspase in a Marine Diatom. Graff van Creveld S, Ben-Dor S, Mizrachi A, Alcolombri U, Hopes A, Mock T, Rosenwasser S, Vardi A. Front Microbiol. 2021 Sep 8;12:688199. doi: 10.3389/fmicb.2021.688199. eCollection 2021. 10.3389/fmicb.2021.688199 PubMed 34566902