pICH47742:PtFCP:Cas9YFP
(Plasmid #104894)

• Purpose: Cas9, with FCP promoter/terminator, Golden Gate Assembly, for Phaeodactylum transformation
• Depositing Lab: Thomas Mock
• Depositing Organization: University of East Anglia
  Located in United Kingdom of Great Britain and Northern Ireland
• Publication: Graff van Creveld et al Front Microbiol. 2021 Sep 8;12:688199. doi: 10.3389/fmicb.2021.688199. eCollection 2021.

Backbone

• Vector backbone: pICH47742
• Backbone size w/o insert (bp): 4968
• Total vector size (bp): 9731
• Vector type: CRISPR ; ; Golden Gate Assembly

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 5382
• Tag / Fusion Protein:
  • YFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: ggataaaccttttcacgccc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Cas9:YFP described in Hopes A, Nekrasov V, Kamoun S, Mock T. Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana. Phaeodactylum promoter and terminator from pPha-TI, described in Zaslavskaia L, Lippmeier C, Kroth P, Grossman A, Apt K. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. PtFCP promoter/terminator were domesticated by removing BpiI sites through site directed mutagenesis.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct was assembled using Golden Gate Cloning.

Please visit https://www.biorxiv.org/content/early/2018/10/17/444109 for bioRxiv preprint.

DNA (Catalog # 104894-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 104894-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.