pICH47742:FCP:Cas9YFP
(Plasmid
#85986)
-
PurposeGolden Gate Level 1 cassette encoding a Cas9-YFP fusion under the FCP promoter
-
Depositing Lab
-
Depositing OrganizationUniversity of East Anglia
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 85986-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 85986-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepICH47742
-
Backbone manufacturerSylvestre Marillonnet (Addgene #48001)
-
Vector typeCRISPR ; Golden Gate Assembly
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes
- Promoter FCP
-
Tag
/ Fusion Protein
- SV40 NLS, YFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer hSpCas9-R1 (CGCTCGTGCTTCTTATCCTC)
- 3′ sequencing primer EXFP-R
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypTpFCP/NAT described in Poulsen N, Chesley PM, Kröger N. Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae), was domesticated by removing BsaI and BpiI sites through site directed mutagenesis. This was then used as a template for the FCP promoter and terminator. A domesticated, S. pyogenes Cas9 with a human codon bias was used.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was assembled using Golden Gate Cloning as described in Hopes et al., 2016.
DNA (Catalog # 85986-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 85986-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH47742:FCP:Cas9YFP was a gift from Thomas Mock (Addgene plasmid # 85986 ; http://n2t.net/addgene:85986 ; RRID:Addgene_85986) -
For your References section:
Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana. Hopes A, Nekrasov V, Kamoun S, Mock T. Plant Methods. 2016 Nov 24;12:49. doi: 10.1186/s13007-016-0148-0. eCollection 2016. 10.1186/s13007-016-0148-0 PubMed 27904648
