Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85984)


Item Catalog # Description Quantity Price (USD)
Plasmid 85984 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Sylvestre Marillonnet (Addgene #48000)
  • Vector type
    Golden Gate Assembly
  • Selectable markers
    Nourseothricin (Nat)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Addgene recommends screening 2-3 colonies via restriction digest before creating a glycerol stock.
  • Copy number


  • Gene/Insert name
  • Alt name
    nourseothricin acetyltransferase
  • Species
    Thalassiosira pseudonana
  • Promoter FCP

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer NrsR-F (TGACCACTCTTGACGACACG)
  • 3′ sequencing primer pBluescript-SK
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pTpFCP/NAT described in Poulsen N, Chesley PM, Kröger N. Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae), was domesticated by removing BsaI and BpiI sites through site directed mutagenesis. The domesticated FCP:NAT cassette was then inserted into an L1 pICH47732 vector.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Depositor Comments

This construct was assembled using Golden Gate Cloning as described in Hopes et al., 2016.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICH47732:FCP:NAT was a gift from Thomas Mock (Addgene plasmid # 85984 ; ; RRID:Addgene_85984)
  • For your References section:

    Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana. Hopes A, Nekrasov V, Kamoun S and Mock T. Plant Methods 2016, 12:49 10.1186/s13007-016-0148-0