Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

YIplac204-T|C-iGFP-RCY1
(Plasmid #105281)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105281 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    YIplac204-TC
  • Backbone size w/o insert (bp) 4108
  • Total vector size (bp) 7666
  • Modifications to backbone
    Includes TPI1 promoter and CYC1 terminator
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rcy1
  • Species
    S. cerevisiae (budding yeast)
  • Entrez Gene
    RCY1 (a.k.a. YJL204C)
  • Promoter TPI1
  • Tag / Fusion Protein
    • iGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI/XmaI (destroyed during cloning)
  • 3′ cloning site HpaI/XbaI (unknown if destroyed)
  • 5′ sequencing primer M13 REVERSE
  • 3′ sequencing primer CGAGCTCGGTACCCGGTCGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YIplac204-T|C-iGFP-RCY1 was a gift from Benjamin Glick (Addgene plasmid # 105281 ; http://n2t.net/addgene:105281 ; RRID:Addgene_105281)
  • For your References section:

    Budding Yeast Has a Minimal Endomembrane System. Day KJ, Casler JC, Glick BS. Dev Cell. 2018 Jan 8;44(1):56-72.e4. doi: 10.1016/j.devcel.2017.12.014. Epub 2018 Jan 8. 10.1016/j.devcel.2017.12.014 PubMed 29316441