Skip to main content

pLIX403_deltaUBA_UBAP2L_mCherry
(Plasmid #105287)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105287 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLIX403
  • Backbone manufacturer
    Addgene plasmid 41393
  • Backbone size w/o insert (bp) 9396
  • Total vector size (bp) 11485
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    UBAP2L
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2994
  • Mutation
    deleted amino acids 20-108
  • GenBank ID
    NM_014847.3
  • Entrez Gene
    UBAP2L (a.k.a. NICE-4, NICE4)
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLIX403_deltaUBA_UBAP2L_mCherry was a gift from Eugene Yeo (Addgene plasmid # 105287 ; http://n2t.net/addgene:105287 ; RRID:Addgene_105287)
  • For your References section:

    Context-Dependent and Disease-Specific Diversity in Protein Interactions within Stress Granules. Markmiller S, Soltanieh S, Server KL, Mak R, Jin W, Fang MY, Luo EC, Krach F, Yang D, Sen A, Fulzele A, Wozniak JM, Gonzalez DJ, Kankel MW, Gao FB, Bennett EJ, Lecuyer E, Yeo GW. Cell. 2018 Jan 25;172(3):590-604.e13. doi: 10.1016/j.cell.2017.12.032. 10.1016/j.cell.2017.12.032 PubMed 29373831