Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #105287)


Item Catalog # Description Quantity Price (USD)
Plasmid 105287 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Addgene plasmid 41393
  • Backbone size w/o insert (bp) 9396
  • Total vector size (bp) 11485
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    deleted amino acids 20-108
  • GenBank ID
  • Entrez Gene
    UBAP2L (a.k.a. NICE-4, FLJ42300, KIAA0144)
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLIX403_deltaUBA_UBAP2L_mCherry was a gift from Eugene Yeo (Addgene plasmid # 105287 ; ; RRID:Addgene_105287)
  • For your References section:

    Context-Dependent and Disease-Specific Diversity in Protein Interactions within Stress Granules. Markmiller S, Soltanieh S, Server KL, Mak R, Jin W, Fang MY, Luo EC, Krach F, Yang D, Sen A, Fulzele A, Wozniak JM, Gonzalez DJ, Kankel MW, Gao FB, Bennett EJ, Lecuyer E, Yeo GW. Cell. 2018 Jan 25;172(3):590-604.e13. doi: 10.1016/j.cell.2017.12.032. 10.1016/j.cell.2017.12.032 PubMed 29373831