pEGFP Tubulin K40A
(Plasmid
#105304)
-
PurposeTo study effects of acetylation-null tubulin
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105304 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namealpha tubulin
-
Alt nameTUBA1B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1350
-
MutationK40A
-
Entrez GeneTUBA1B (a.k.a. K-ALPHA-1)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Original pEGFP-Tub from Clontech. Mutation in Tubulin was introduced by using site-directed mutagenesis kit (Stratagene)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP Tubulin K40A was a gift from Kenneth Yamada (Addgene plasmid # 105304 ; http://n2t.net/addgene:105304 ; RRID:Addgene_105304) -
For your References section:
MYPT1 regulates contractility and microtubule acetylation to modulate integrin adhesions and matrix assembly. Joo EE, Yamada KM. Nat Commun. 2014 Mar 25;5:3510. doi: 10.1038/ncomms4510. 10.1038/ncomms4510 PubMed 24667306